Transcript: Mouse XM_011239733.2

PREDICTED: Mus musculus SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) (Sys1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sys1 (66460)
Length:
1961
CDS:
663..1133

Additional Resources:

NCBI RefSeq record:
XM_011239733.2
NBCI Gene record:
Sys1 (66460)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239733.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125773 CCAGATGTTCGACGCGGAGAT pLKO.1 806 CDS 100% 1.350 1.890 N Sys1 n/a
2 TRCN0000315482 CCAGATGTTCGACGCGGAGAT pLKO_005 806 CDS 100% 1.350 1.890 N Sys1 n/a
3 TRCN0000125772 ACTGTCACTGTGCATTTCTTT pLKO.1 945 CDS 100% 5.625 4.500 N Sys1 n/a
4 TRCN0000315481 ACTGTCACTGTGCATTTCTTT pLKO_005 945 CDS 100% 5.625 4.500 N Sys1 n/a
5 TRCN0000125771 CTCATGCAGACCGTCTACTAT pLKO.1 723 CDS 100% 5.625 3.938 N Sys1 n/a
6 TRCN0000303256 CTCATGCAGACCGTCTACTAT pLKO_005 723 CDS 100% 5.625 3.938 N Sys1 n/a
7 TRCN0000125770 GTTGCTAATCCTGTCGCAGAT pLKO.1 698 CDS 100% 4.050 2.835 N Sys1 n/a
8 TRCN0000303185 GTTGCTAATCCTGTCGCAGAT pLKO_005 698 CDS 100% 4.050 2.835 N Sys1 n/a
9 TRCN0000125769 CCTGGAAATGTGAAGTCTGTT pLKO.1 1229 3UTR 100% 4.950 2.970 N Sys1 n/a
10 TRCN0000303257 CCTGGAAATGTGAAGTCTGTT pLKO_005 1229 3UTR 100% 4.950 2.970 N Sys1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239733.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04507 pDONR223 100% 94.2% 97.4% None (many diffs) n/a
2 ccsbBroad304_04507 pLX_304 0% 94.2% 97.4% V5 (many diffs) n/a
3 TRCN0000478328 CACTACCTCATGAAATGAGAACCA pLX_317 60.8% 94.2% 97.4% V5 (many diffs) n/a
Download CSV