Transcript: Mouse XM_011239896.2

PREDICTED: Mus musculus small nuclear ribonucleoprotein Sm D1-like (LOC105244345), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC105244345 (105244345)
Length:
531
CDS:
153..428

Additional Resources:

NCBI RefSeq record:
XM_011239896.2
NBCI Gene record:
LOC105244345 (105244345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239896.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295005 CGATAATGTCTCTCAAGATTA pLKO_005 423 CDS 100% 13.200 6.600 Y Snrpd1 n/a
2 TRCN0000295003 ACACAAGTCCATGGAACAATC pLKO_005 258 CDS 100% 10.800 5.400 Y Snrpd1 n/a
3 TRCN0000295073 ATTGAGTCATGAAACTGTAAC pLKO_005 218 CDS 100% 10.800 5.400 Y Snrpd1 n/a
4 TRCN0000123403 GATACACTACTTGTGGATGTT pLKO.1 297 CDS 100% 4.950 2.475 Y Snrpd1 n/a
5 TRCN0000287520 GATACACTACTTGTGGATGTT pLKO_005 297 CDS 100% 4.950 2.475 Y Snrpd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239896.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469783 GTGTCATAAGCGTCGATGCACCCT pLX_317 84% 55% 56.8% V5 (many diffs) n/a
2 ccsbBroadEn_06983 pDONR223 100% 54.7% 56% None (many diffs) n/a
3 ccsbBroad304_06983 pLX_304 0% 54.7% 56% V5 (many diffs) n/a
Download CSV