Transcript: Mouse XM_011240111.1

PREDICTED: Mus musculus tRNA methyltransferase 13 (Trmt13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trmt13 (229780)
Length:
1925
CDS:
404..1606

Additional Resources:

NCBI RefSeq record:
XM_011240111.1
NBCI Gene record:
Trmt13 (229780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254682 TGGCGACAGATGTTGCATTAC pLKO_005 969 CDS 100% 10.800 15.120 N Trmt13 n/a
2 TRCN0000062721 CCAAACGCATAAAGAATGATA pLKO.1 1047 CDS 100% 5.625 7.875 N TRMT13 n/a
3 TRCN0000254681 AGCAGTTGGAGAACTTAATTA pLKO_005 510 CDS 100% 15.000 10.500 N Trmt13 n/a
4 TRCN0000365811 ACCTTTAGCCAAACGCATAAA pLKO_005 1039 CDS 100% 13.200 9.240 N TRMT13 n/a
5 TRCN0000254683 ATTATCTCACTGGGTTGATAT pLKO_005 745 CDS 100% 13.200 9.240 N Trmt13 n/a
6 TRCN0000254680 ATGGCGATTGTGCAGTCAAAC pLKO_005 627 CDS 100% 10.800 7.560 N Trmt13 n/a
7 TRCN0000254679 CATTGCATGATGCCCTTAATG pLKO_005 597 CDS 100% 13.200 7.920 N Trmt13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08384 pDONR223 100% 71.1% 70.3% None (many diffs) n/a
2 ccsbBroad304_08384 pLX_304 0% 71.1% 70.3% V5 (many diffs) n/a
3 TRCN0000476829 GTGTCGCTTGACTGTGAATTTATG pLX_317 24.2% 71.1% 70.3% V5 (many diffs) n/a
Download CSV