Transcript: Mouse XM_011240190.2

PREDICTED: Mus musculus regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1 (Riiad1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Riiad1 (66353)
Length:
622
CDS:
95..454

Additional Resources:

NCBI RefSeq record:
XM_011240190.2
NBCI Gene record:
Riiad1 (66353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424776 AGAGAAGAAAGGAACCTAATT pLKO_005 436 CDS 100% 13.200 9.240 N Riiad1 n/a
2 TRCN0000177645 CCGGACAACATTCTTGAATTT pLKO.1 356 CDS 100% 13.200 9.240 N Riiad1 n/a
3 TRCN0000435794 AGTACTTGAGAACCCACAAAG pLKO_005 285 CDS 100% 10.800 7.560 N Riiad1 n/a
4 TRCN0000216498 CTAATTAGCAAAGCCACAATG pLKO.1 451 CDS 100% 10.800 7.560 N Riiad1 n/a
5 TRCN0000181562 GAAGAGAAGAAGCCTGGATTT pLKO.1 123 CDS 100% 10.800 7.560 N Riiad1 n/a
6 TRCN0000197455 CATGCAGCTAATTAAAGAGAA pLKO.1 421 CDS 100% 4.950 3.465 N Riiad1 n/a
7 TRCN0000176963 GCAGCTAATTAAAGAGAAGAA pLKO.1 424 CDS 100% 4.950 3.465 N Riiad1 n/a
8 TRCN0000181893 GCAGTTGCGAGATTTCAAGAT pLKO.1 241 CDS 100% 4.950 3.465 N Riiad1 n/a
9 TRCN0000200218 CAAAGAGGTGTCTCTGCTCAT pLKO.1 301 CDS 100% 4.050 2.835 N Riiad1 n/a
10 TRCN0000181652 GATTTCTTTCGGCAAGCACAA pLKO.1 139 CDS 100% 4.050 2.835 N Riiad1 n/a
11 TRCN0000182297 GCTGCACACTATTTCACGGAT pLKO.1 377 CDS 100% 2.640 1.848 N Riiad1 n/a
12 TRCN0000419623 TCTGCTCATCAGCGGCTTCTT pLKO_005 313 CDS 100% 4.950 2.970 N Riiad1 n/a
13 TRCN0000177083 CTTCAGAGAAATGTTTCTGAA pLKO.1 331 CDS 100% 0.495 0.297 N Riiad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.