Transcript: Mouse XM_011240200.1

PREDICTED: Mus musculus tripartite motif-containing 59 (Trim59), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim59 (66949)
Length:
2993
CDS:
280..1491

Additional Resources:

NCBI RefSeq record:
XM_011240200.1
NBCI Gene record:
Trim59 (66949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295041 ACAGATATCACTCGCCTTATT pLKO_005 751 CDS 100% 13.200 18.480 N Trim59 n/a
2 TRCN0000040509 CAGAATAGAAATTGGACGTAT pLKO.1 1149 CDS 100% 4.950 6.930 N Trim59 n/a
3 TRCN0000040508 CCAGAGTTTATCTAAGAACTT pLKO.1 1395 CDS 100% 4.950 6.930 N Trim59 n/a
4 TRCN0000294979 GATGCAGAGAAATACGATAAA pLKO_005 1606 3UTR 100% 13.200 10.560 N Trim59 n/a
5 TRCN0000294980 ACACTACAGGCAACCATTAAA pLKO_005 576 CDS 100% 15.000 10.500 N Trim59 n/a
6 TRCN0000307483 CTTTGCATTACGAGCAATTAT pLKO_005 507 CDS 100% 15.000 10.500 N Trim59 n/a
7 TRCN0000040512 CCCATCTGTTACAGCATCTTT pLKO.1 310 CDS 100% 5.625 3.938 N Trim59 n/a
8 TRCN0000040511 CTCCACTTAAATTTCTGGAAA pLKO.1 1016 CDS 100% 4.950 3.465 N Trim59 n/a
9 TRCN0000040510 GCATAGAATCCTTACCTGTAA pLKO.1 485 CDS 100% 4.950 3.465 N Trim59 n/a
10 TRCN0000287572 GCATAGAATCCTTACCTGTAA pLKO_005 485 CDS 100% 4.950 3.465 N Trim59 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05419 pDONR223 100% 85.7% 82.6% None (many diffs) n/a
2 ccsbBroad304_05419 pLX_304 0% 85.7% 82.6% V5 (many diffs) n/a
3 TRCN0000469426 ACGATACCACTCTATACAGACCAT pLX_317 33.3% 85.7% 82.6% V5 (many diffs) n/a
Download CSV