Transcript: Mouse XM_011240244.2

PREDICTED: Mus musculus ventricular zone expressed PH domain-containing 1 (Veph1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Veph1 (72789)
Length:
1281
CDS:
511..1197

Additional Resources:

NCBI RefSeq record:
XM_011240244.2
NBCI Gene record:
Veph1 (72789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15987 pDONR223 0% 67.8% 64.5% None (many diffs) n/a
2 ccsbBroad304_15987 pLX_304 0% 67.8% 64.5% V5 (many diffs) n/a
3 TRCN0000471028 CCGGGAAATGGTCAAATTATAAAT pLX_317 67.5% 67.8% 64.5% V5 (many diffs) n/a
4 ccsbBroadEn_04106 pDONR223 100% 19.7% 19.1% None (many diffs) n/a
5 ccsbBroad304_04106 pLX_304 0% 19.7% 19.1% V5 (many diffs) n/a
6 TRCN0000472697 CAATACCTGCAAAGTACAACAGAT pLX_317 16.6% 19.7% 19.1% V5 (many diffs) n/a
Download CSV