Transcript: Mouse XM_011240538.2

PREDICTED: Mus musculus antizyme inhibitor 2 (Azin2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Azin2 (242669)
Length:
1722
CDS:
287..1381

Additional Resources:

NCBI RefSeq record:
XM_011240538.2
NBCI Gene record:
Azin2 (242669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115385 ACTACCTTGATGAGGGCGTTT pLKO.1 948 CDS 100% 4.050 5.670 N Azin2 n/a
2 TRCN0000115382 CCTGGCTTAGAGGGAGCCAAA pLKO.1 719 CDS 100% 0.135 0.189 N Azin2 n/a
3 TRCN0000115381 CCCTAAGAGCATCGTGTACTA pLKO.1 931 CDS 100% 4.950 3.465 N Azin2 n/a
4 TRCN0000115383 CAGTAAGATCATCTGTGCCAA pLKO.1 319 CDS 100% 2.640 1.848 N Azin2 n/a
5 TRCN0000115384 GCGGATGCTAGGCTGGTGTTT pLKO.1 641 CDS 100% 1.650 1.155 N Azin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04649 pDONR223 100% 68.8% 67.3% None (many diffs) n/a
2 ccsbBroad304_04649 pLX_304 0% 68.8% 67.3% V5 (many diffs) n/a
3 TRCN0000492272 CACACAGCCCCATTCCCGTTGGGC pLX_317 28.5% 68.8% 67.3% V5 (many diffs) n/a
Download CSV