Construct: ORF TRCN0000492272
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005223.1_s317c1
- Derived from:
- ccsbBroadEn_04649
- DNA Barcode:
- CACACAGCCCCATTCCCGTTGGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AZIN2 (113451)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492272
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001293562.2 | 100% | 100% | |
| 2 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_052998.4 | 100% | 100% | |
| 3 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_005270404.2 | 100% | 100% | |
| 4 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001301825.1 | 95.8% | 95.8% | 916_975del |
| 5 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_005270406.1 | 87.3% | 87.3% | 104_105ins174 |
| 6 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_011540557.1 | 87.3% | 87.3% | 104_105ins174 |
| 7 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000167.1 | 80.1% | 75.1% | (many diffs) |
| 8 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001301823.2 | 79.3% | 79.3% | 0_1ins285 |
| 9 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001301824.2 | 79.3% | 79.3% | 0_1ins285 |
| 10 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001350398.2 | 79.3% | 79.3% | 0_1ins285 |
| 11 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001350399.2 | 79.3% | 79.3% | 0_1ins285 |
| 12 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001350400.2 | 79.3% | 79.3% | 0_1ins285 |
| 13 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001350401.2 | 79.3% | 79.3% | 0_1ins285 |
| 14 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_005270407.2 | 79.3% | 79.3% | 0_1ins285 |
| 15 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000171.1 | 79.3% | 79.3% | 0_1ins285 |
| 16 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000173.2 | 79.3% | 79.3% | 0_1ins285 |
| 17 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000175.1 | 79.3% | 79.3% | 0_1ins285 |
| 18 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_024452817.1 | 79.3% | 79.3% | 0_1ins285 |
| 19 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_024452818.1 | 79.3% | 79.3% | 0_1ins285 |
| 20 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001301826.1 | 76.7% | 75.5% | (many diffs) |
| 21 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_011540563.1 | 76.7% | 75.5% | (many diffs) |
| 22 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000174.1 | 75.9% | 68% | (many diffs) |
| 23 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_011540566.1 | 75.1% | 66.1% | (many diffs) |
| 24 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NR_126031.1 | 71.3% | (many diffs) | |
| 25 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NM_001350402.1 | 67.1% | 67.1% | 0_1ins453 |
| 26 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_006710312.1 | 67.1% | 67.1% | 0_1ins453 |
| 27 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000176.1 | 67.1% | 67.1% | 0_1ins453 |
| 28 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_017000178.1 | 67.1% | 67.1% | 0_1ins453 |
| 29 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XM_024452824.1 | 67.1% | 67.1% | 0_1ins453 |
| 30 | human | 113451 | AZIN2 | antizyme inhibitor 2 | XR_946531.1 | 66.5% | 1_332del;1248_1258del;1724_2075del | |
| 31 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NR_146649.2 | 27.2% | (many diffs) | |
| 32 | human | 113451 | AZIN2 | antizyme inhibitor 2 | NR_146648.2 | 25.9% | (many diffs) | |
| 33 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | NM_172875.4 | 87.4% | 86% | (many diffs) |
| 34 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | XM_006503106.3 | 76.3% | 75% | (many diffs) |
| 35 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | XM_006503107.2 | 71.5% | 66% | (many diffs) |
| 36 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | XM_006503108.3 | 69.9% | 68% | (many diffs) |
| 37 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | XM_011240538.2 | 68.8% | 67.3% | (many diffs) |
| 38 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | NM_001301841.1 | 60.3% | 58.8% | (many diffs) |
| 39 | mouse | 242669 | Azin2 | antizyme inhibitor 2 | XR_001784145.1 | 53% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1446
- ORF length:
- 1380
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tggctacctg agtgaatcgg actttgtgat ggtggaggag ggcttcagta 121 cccgagacct gctgaaggaa ctcactctgg gggcctcaca ggccaccacg gacgaggtag 181 ctgccttctt cgtggctgac ctgggtgcca tagtgaggaa gcacttttgc tttctgaagt 241 gcctgccacg agtccggccc ttttatgctg tcaagtgcaa cagcagccca ggtgtgctga 301 aggttctggc ccagctgggg ctgggcttta gctgtgccaa caaggcagag atggagttgg 361 tccagcatat tggaatccct gccagtaaga tcatctgcgc caacccctgt aagcaaattg 421 cacagatcaa atatgctgcc aagcatggga tccagctgct gagctttgac aatgagatgg 481 agctggcaaa ggtggtaaag agccacccca gtgccaagat ggttctgtgc attgctaccg 541 atgactccca ctccctgagc tgcctgagcc taaagtttgg agtgtcactg aaatcctgca 601 gacacctgct tgaaaatgcg aagaagcacc atgtggaggt ggtgggtgtg agttttcaca 661 ttggcagtgg ctgtcctgac cctcaggcct atgctcagtc catcgcagac gcccggctcg 721 tgtttgaaat gggcaccgag ctgggtcaca agatgcacgt tctggacctt ggtggtggct 781 tccctggcac agaaggggcc aaagtgagat ttgaagagat tgcttccgtg atcaactcag 841 ccttggacct gtacttccca gagggctgtg gcgtggacat ctttgctgag ctggggcgct 901 actacgtgac ctcggccttc actgtggcag tcagcatcat tgccaagaag gaggttctgc 961 tagaccagcc tggcagggag gaggaaaatg gttccacctc caagaccatc gtgtaccacc 1021 ttgatgaggg cgtgtatggg atcttcaact cagtccTGTT TGACAACATC TGCCCTACCC 1081 CCATCCTGCA GAAGAAACCA TCCACGGAGC AGCCCCTGTA CAGCAGCAGC CTGTGGGGCC 1141 CGGCGGTTGA TGGCTGTGAT TGCGTGGCTG AGGGCCTGTG GCTGCCGCAA CTACACGTAG 1201 GGGACTGGCT GGTCTTTGAC AACATGGGCG CCTACACTGT GGGCATGGGT TCCCCCTTTT 1261 GGGGGACCCA GGCCTGCCAC ATCACCTATG CCATGTCCCG GGTGGCCTGG GAAGCGCTGC 1321 GAAGGCAGCT GATGGCTGCA GAACAGGAGG ATGACGTGGA GGGTGTGTGC AAGCCTCTGT 1381 CCTGCGGCTG GGAGATCACA GACACCCTGT GCGTGGGCCC TGTCTTCACC CCAGCGAGCA 1441 TCATGTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1501 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1561 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACACACAGCC CCATTCCCGT TGGGCACGCG 1621 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt