Transcript: Mouse XM_011240556.2

PREDICTED: Mus musculus acyl-CoA thioesterase 11 (Acot11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acot11 (329910)
Length:
5605
CDS:
92..1831

Additional Resources:

NCBI RefSeq record:
XM_011240556.2
NBCI Gene record:
Acot11 (329910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176533 CTATGTTCTCTAATCGCACAT pLKO.1 90 5UTR 100% 4.050 5.670 N Acot11 n/a
2 TRCN0000198603 CATACCATTAGTGTCGGCCAA pLKO.1 353 CDS 100% 2.160 3.024 N Acot11 n/a
3 TRCN0000176692 CCTGACATTCAACAGAATTTA pLKO.1 3325 3UTR 100% 15.000 10.500 N Acot11 n/a
4 TRCN0000176777 CCAAAGTTTCAGATTCCTAAT pLKO.1 5027 3UTR 100% 10.800 7.560 N Acot11 n/a
5 TRCN0000177034 GATGACTAAGGTTTCTTACTA pLKO.1 1666 CDS 100% 5.625 3.938 N Acot11 n/a
6 TRCN0000177939 GACACCATCAAAGATCTCCTA pLKO.1 617 CDS 100% 2.640 1.848 N Acot11 n/a
7 TRCN0000198823 CTACAACGTGTCCTCTCTGAA pLKO.1 1216 CDS 100% 4.950 2.970 N Acot11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11800 pDONR223 100% 33.2% 34.1% None (many diffs) n/a
2 ccsbBroad304_11800 pLX_304 0% 33.2% 34.1% V5 (many diffs) n/a
3 TRCN0000469811 AACCTTTGGGAGCGGCCTATGTGG pLX_317 74.9% 33.2% 34.1% V5 (many diffs) n/a
Download CSV