Transcript: Mouse XM_011240648.1

PREDICTED: Mus musculus Smad nuclear interacting protein 1 (Snip1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snip1 (76793)
Length:
2433
CDS:
443..1309

Additional Resources:

NCBI RefSeq record:
XM_011240648.1
NBCI Gene record:
Snip1 (76793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120768 CCTACATTATCGACCTTGGCT pLKO.1 1095 CDS 100% 0.750 0.600 N Snip1 n/a
2 TRCN0000366306 GAGGGTGAAGCCCTACATTAT pLKO_005 1084 CDS 100% 13.200 9.240 N Snip1 n/a
3 TRCN0000375040 TCTGAACAGTCTCACCAATTA pLKO_005 1495 3UTR 100% 13.200 9.240 N Snip1 n/a
4 TRCN0000366357 TTGAGTCATAGAAGTTGATTT pLKO_005 1760 3UTR 100% 13.200 9.240 N Snip1 n/a
5 TRCN0000366308 GGCTCAGGCAATGGAACATTC pLKO_005 1112 CDS 100% 10.800 7.560 N Snip1 n/a
6 TRCN0000120767 CCACACTTCCAGTTCATCTTT pLKO.1 2135 3UTR 100% 5.625 3.938 N Snip1 n/a
7 TRCN0000375094 AGGTACTTCCAGTCATGTACA pLKO_005 921 CDS 100% 4.950 3.465 N Snip1 n/a
8 TRCN0000375038 AGTCACCACGGACCAAGAGAA pLKO_005 402 5UTR 100% 4.950 3.465 N Snip1 n/a
9 TRCN0000120771 CAGTAGCAGAGAATATGTCTT pLKO.1 1204 CDS 100% 4.950 3.465 N Snip1 n/a
10 TRCN0000120770 AGAAATGGTATCTGACAGCTA pLKO.1 1288 CDS 100% 2.640 1.848 N Snip1 n/a
11 TRCN0000120769 AGACGTACTTAAATTTGGGTT pLKO.1 1183 CDS 100% 2.640 1.848 N Snip1 n/a
12 TRCN0000375041 GCCCGTTAAAGAGAAACCAAG pLKO_005 772 CDS 100% 4.050 2.430 N Snip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04118 pDONR223 100% 62.9% 66.1% None (many diffs) n/a
2 ccsbBroad304_04118 pLX_304 0% 62.9% 66.1% V5 (many diffs) n/a
3 TRCN0000492147 TCGCGTGTACACTTAGTATTCAGC pLX_317 29.3% 62.9% 66.1% V5 (many diffs) n/a
Download CSV