Transcript: Mouse XM_011240907.2

PREDICTED: Mus musculus transmembrane protein 248 (Tmem248), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem248 (71667)
Length:
3420
CDS:
108..1052

Additional Resources:

NCBI RefSeq record:
XM_011240907.2
NBCI Gene record:
Tmem248 (71667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267855 ATCGTTTGGAACCTGGTATTT pLKO_005 3189 3UTR 100% 13.200 18.480 N Tmem248 n/a
2 TRCN0000267858 CCAGATGACGACCGCTCATTA pLKO_005 882 CDS 100% 13.200 18.480 N Tmem248 n/a
3 TRCN0000167131 CAATCCTTTCTGGTGTTATAA pLKO.1 806 CDS 100% 15.000 10.500 N TMEM248 n/a
4 TRCN0000263728 CAATCCTTTCTGGTGTTATAA pLKO_005 806 CDS 100% 15.000 10.500 N TMEM248 n/a
5 TRCN0000267822 CAATCCTTTCTGGTGTTATAA pLKO_005 806 CDS 100% 15.000 10.500 N Tmem248 n/a
6 TRCN0000267810 CAGAGATGCCAACACGAAATA pLKO_005 773 CDS 100% 13.200 9.240 N Tmem248 n/a
7 TRCN0000267857 TTTGGAGGGTACTCTCGAAAT pLKO_005 483 CDS 100% 10.800 7.560 N Tmem248 n/a
8 TRCN0000172530 GCATCTCATGCACACCAGTTA pLKO.1 911 CDS 100% 4.950 3.465 N TMEM248 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03514 pDONR223 100% 86.7% 94.5% None (many diffs) n/a
2 ccsbBroad304_03514 pLX_304 0% 86.7% 94.5% V5 (many diffs) n/a
3 TRCN0000471643 ACTGAGCAAGTCCCCCTTCCTATA pLX_317 52.1% 86.7% 94.5% V5 (many diffs) n/a
Download CSV