Transcript: Mouse XM_011240988.2

PREDICTED: Mus musculus monocyte to macrophage differentiation-associated 2 (Mmd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mmd2 (75104)
Length:
2608
CDS:
661..1350

Additional Resources:

NCBI RefSeq record:
XM_011240988.2
NBCI Gene record:
Mmd2 (75104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101116 CGACAGGATGGTGATCTACTT pLKO.1 927 CDS 100% 4.950 6.930 N Mmd2 n/a
2 TRCN0000101119 GATCGACAGGATGGTGATCTA pLKO.1 924 CDS 100% 4.950 6.930 N Mmd2 n/a
3 TRCN0000101118 CTCTTTGTGGTATCCACCATT pLKO.1 844 CDS 100% 4.950 3.465 N Mmd2 n/a
4 TRCN0000101117 CTGAGTATGAACACGCAGCAA pLKO.1 701 CDS 100% 2.640 1.848 N Mmd2 n/a
5 TRCN0000101115 GCCCTTTCTATGGAGGAGAAA pLKO.1 1521 3UTR 100% 0.495 0.347 N Mmd2 n/a
6 TRCN0000437450 CCCATGCTTTCTGGATCATCC pLKO_005 731 CDS 100% 4.050 2.835 N MMD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14443 pDONR223 100% 82.6% 88.2% None (many diffs) n/a
2 ccsbBroad304_14443 pLX_304 0% 82.6% 88.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479807 CACGACGGATGCCAAAATTATGAA pLX_317 46.7% 82.6% 88.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV