Transcript: Mouse XM_011241068.2

PREDICTED: Mus musculus striatin interacting protein 2 (Strip2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Strip2 (320609)
Length:
2822
CDS:
100..2139

Additional Resources:

NCBI RefSeq record:
XM_011241068.2
NBCI Gene record:
Strip2 (320609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215819 CATTGCAGATATACAGATAAA pLKO.1 1548 CDS 100% 13.200 18.480 N Strip2 n/a
2 TRCN0000144412 CTACAATGAAAGGGATCTCTT pLKO.1 1200 CDS 100% 4.950 6.930 N STRIP2 n/a
3 TRCN0000264785 TCTAAAGCAGCACAAGTATAT pLKO_005 1524 CDS 100% 13.200 9.240 N Strip2 n/a
4 TRCN0000264786 CAGTAGGGAGAAACGGCTTAA pLKO_005 486 CDS 100% 10.800 7.560 N Strip2 n/a
5 TRCN0000283172 CTGAGTGTCATGTACCTAATG pLKO_005 736 CDS 100% 10.800 7.560 N Strip2 n/a
6 TRCN0000192120 CACACATAATGAAGAGCCGTT pLKO.1 843 CDS 100% 2.160 1.512 N Strip2 n/a
7 TRCN0000215324 CTAAGACAGACTCTATCAATA pLKO.1 1727 CDS 100% 13.200 7.920 N Strip2 n/a
8 TRCN0000264784 CTAAGACAGACTCTATCAATA pLKO_005 1727 CDS 100% 13.200 7.920 N Strip2 n/a
9 TRCN0000144910 GCTAAGACAGACTCTATCAAT pLKO.1 1726 CDS 100% 5.625 3.375 N STRIP2 n/a
10 TRCN0000121875 GACATCTACAATGAAAGGGAT pLKO.1 1195 CDS 100% 2.640 1.584 N STRIP2 n/a
11 TRCN0000141806 GAGTTGGAAGAAGATGCCCAA pLKO.1 424 CDS 100% 2.160 1.296 N STRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03824 pDONR223 100% 77.7% 80.9% None (many diffs) n/a
2 ccsbBroad304_03824 pLX_304 0% 77.7% 80.9% V5 (many diffs) n/a
Download CSV