Transcript: Mouse XM_011241159.2

PREDICTED: Mus musculus apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Apobec1 (11810)
Length:
2169
CDS:
469..1158

Additional Resources:

NCBI RefSeq record:
XM_011241159.2
NBCI Gene record:
Apobec1 (11810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304873 TTAGGACTTCCACCCTGTTTA pLKO_005 1027 CDS 100% 13.200 18.480 N Apobec1 n/a
2 TRCN0000098681 CGGTGTGACTATCCAGATCAT pLKO.1 879 CDS 100% 4.950 6.930 N Apobec1 n/a
3 TRCN0000311145 ACGTTGAAGTCAACTTCTTAG pLKO_005 650 CDS 100% 10.800 8.640 N Apobec1 n/a
4 TRCN0000098684 CGGCTTTATCACCACACGGAT pLKO.1 820 CDS 100% 2.640 2.112 N Apobec1 n/a
5 TRCN0000304817 CAAGGACTCAGGGACCTTATT pLKO_005 853 CDS 100% 13.200 9.240 N Apobec1 n/a
6 TRCN0000098682 CCACGAGTTTGAAGTCTTCTT pLKO.1 528 CDS 100% 4.950 3.465 N Apobec1 n/a
7 TRCN0000316592 CCACGAGTTTGAAGTCTTCTT pLKO_005 528 CDS 100% 4.950 3.465 N Apobec1 n/a
8 TRCN0000098680 CCTTGGTTTAATTCCAAGAAT pLKO.1 1313 3UTR 100% 0.563 0.394 N Apobec1 n/a
9 TRCN0000316518 CCTTGGTTTAATTCCAAGAAT pLKO_005 1313 3UTR 100% 0.563 0.394 N Apobec1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.