Transcript: Mouse XM_011241220.2

PREDICTED: Mus musculus glutamate receptor, ionotropic, NMDA2B (epsilon 2) (Grin2b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grin2b (14812)
Length:
7383
CDS:
909..5357

Additional Resources:

NCBI RefSeq record:
XM_011241220.2
NBCI Gene record:
Grin2b (14812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100232 GCCAAATCTAGGAGGGAGTTT pLKO.1 4194 CDS 100% 4.950 6.930 N Grin2b n/a
2 TRCN0000100233 CGATCTTATGTCTGACCGGAA pLKO.1 1166 CDS 100% 2.160 3.024 N Grin2b n/a
3 TRCN0000100234 CCGTAATAACTATGCAGAAAT pLKO.1 2993 CDS 100% 13.200 9.240 N Grin2b n/a
4 TRCN0000100231 GCTATGGCATTGCTATCCAAA pLKO.1 3190 CDS 100% 4.950 3.465 N Grin2b n/a
5 TRCN0000100230 GCTGGTGATAATCCTTCTGAA pLKO.1 1991 CDS 100% 4.950 3.465 N Grin2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476032 CAGCTATCTCGCAGTATGCAGTTT pLX_317 8.5% 91.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV