Transcript: Mouse XM_011241225.2

PREDICTED: Mus musculus homeobox A3 (Hoxa3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hoxa3 (15400)
Length:
2572
CDS:
363..1694

Additional Resources:

NCBI RefSeq record:
XM_011241225.2
NBCI Gene record:
Hoxa3 (15400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095529 CCGACCTTCTTTGGTTACTTT pLKO.1 1733 3UTR 100% 5.625 7.875 N Hoxa3 n/a
2 TRCN0000095530 GCCAATGGGTTCGCTTACAAT pLKO.1 423 CDS 100% 5.625 7.875 N Hoxa3 n/a
3 TRCN0000095533 ACCGTGGGCAAACAAATCTTT pLKO.1 813 CDS 100% 5.625 3.938 N Hoxa3 n/a
4 TRCN0000095531 GCTGGTCAACAGTGTCCCATA pLKO.1 1211 CDS 100% 4.050 2.835 N Hoxa3 n/a
5 TRCN0000017191 CCATCCTTCTCAGGGAAGAAT pLKO.1 1643 CDS 100% 5.625 3.375 N HOXA3 n/a
6 TRCN0000273959 CCATCCTTCTCAGGGAAGAAT pLKO_005 1643 CDS 100% 5.625 3.375 N HOXA3 n/a
7 TRCN0000427911 CCATCCTTCTCAGGGAAGAAT pLKO_005 1643 CDS 100% 5.625 3.375 N Hoxa3 n/a
8 TRCN0000095532 CGCCGCATGAAGTACAAGAAA pLKO.1 1089 CDS 100% 5.625 3.375 N Hoxa3 n/a
9 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1067 CDS 100% 4.050 2.025 Y Hoxa3 n/a
10 TRCN0000413913 TCACCGAGCGCCAGATCAAGA pLKO_005 1054 CDS 100% 1.650 0.825 Y Hoxa3 n/a
11 TRCN0000436751 CAACCTGCTGAACCTCACCGA pLKO_005 1040 CDS 100% 0.220 0.110 Y Hoxa3 n/a
12 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 1075 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14669 pDONR223 97.1% 88.4% 93.4% None (many diffs) n/a
2 ccsbBroad304_14669 pLX_304 0% 88.4% 93.4% V5 (many diffs) n/a
3 TRCN0000467541 CTACTCATTGAAATTAGCGAACCT pLX_317 31.7% 88.4% 93.4% V5 (many diffs) n/a
Download CSV