Transcript: Mouse XM_011241285.2

PREDICTED: Mus musculus cytotoxic granule-associated RNA binding protein 1 (Tia1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tia1 (21841)
Length:
4536
CDS:
1249..2106

Additional Resources:

NCBI RefSeq record:
XM_011241285.2
NBCI Gene record:
Tia1 (21841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418875 ACTAACTGGGCAACCCGAAAG pLKO_005 1480 CDS 100% 6.000 8.400 N TIA1 n/a
2 TRCN0000077158 CGATGGTGGATGTTTGCCAAT pLKO.1 2287 3UTR 100% 4.050 5.670 N Tia1 n/a
3 TRCN0000301302 CGATGGTGGATGTTTGCCAAT pLKO_005 2287 3UTR 100% 4.050 5.670 N Tia1 n/a
4 TRCN0000077161 CATGCGATTGTTTCTGTTAAT pLKO.1 1735 CDS 100% 13.200 9.240 N Tia1 n/a
5 TRCN0000301378 CATGCGATTGTTTCTGTTAAT pLKO_005 1735 CDS 100% 13.200 9.240 N Tia1 n/a
6 TRCN0000077162 CAGGAAATGACCCATACTGTT pLKO.1 394 5UTR 100% 4.950 3.465 N Tia1 n/a
7 TRCN0000077160 GCACAACAGATTGGCCAGTAT pLKO.1 1891 CDS 100% 4.950 3.465 N Tia1 n/a
8 TRCN0000301380 GCACAACAGATTGGCCAGTAT pLKO_005 1891 CDS 100% 4.950 3.465 N Tia1 n/a
9 TRCN0000077159 CGAAGACATCAAAGCAGCGTT pLKO.1 1302 CDS 100% 2.640 1.848 N Tia1 n/a
10 TRCN0000301379 CGAAGACATCAAAGCAGCGTT pLKO_005 1302 CDS 100% 2.640 1.848 N Tia1 n/a
11 TRCN0000074466 CGGAAGATAATGGGTAAGGAA pLKO.1 471 5UTR 100% 3.000 1.800 N TIA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13969 pDONR223 100% 26.3% 24% None (many diffs) n/a
2 ccsbBroad304_13969 pLX_304 0% 26.3% 24% V5 (many diffs) n/a
3 TRCN0000474455 ACAACGAGCAACAAACGTTGGTTG pLX_317 71.6% 26.1% 24% V5 (many diffs) n/a
Download CSV