Transcript: Mouse XM_011241386.2

PREDICTED: Mus musculus SV2 related protein homolog (rat)-like (Svopl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Svopl (320590)
Length:
3343
CDS:
125..1759

Additional Resources:

NCBI RefSeq record:
XM_011241386.2
NBCI Gene record:
Svopl (320590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126828 GCCATGGAGATCATGTTAATA pLKO.1 308 CDS 100% 15.000 21.000 N Svopl n/a
2 TRCN0000126825 CCCTGCTATTGCCACATATTT pLKO.1 1127 CDS 100% 15.000 12.000 N Svopl n/a
3 TRCN0000126826 GCCTTCAAGTTTATCCCTGAA pLKO.1 776 CDS 100% 4.050 2.835 N Svopl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09566 pDONR223 100% 54.5% 56.6% None (many diffs) n/a
2 ccsbBroad304_09566 pLX_304 0% 54.5% 56.6% V5 (many diffs) n/a
3 TRCN0000475193 TTACGGATGTACCCATGTAAGGAC pLX_317 28.6% 54.5% 56.6% V5 (many diffs) n/a
Download CSV