Transcript: Mouse XM_011241863.1

PREDICTED: Mus musculus septin 1 (Sept1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sept1 (54204)
Length:
1359
CDS:
372..1265

Additional Resources:

NCBI RefSeq record:
XM_011241863.1
NBCI Gene record:
Sept1 (54204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417789 AGATCCGGGACCAGTTGAAAG pLKO_005 1156 CDS 100% 10.800 7.560 N Sept1 n/a
2 TRCN0000101794 CGCTTCATTGAGGAGCAGTTT pLKO.1 921 CDS 100% 4.950 3.465 N Sept1 n/a
3 TRCN0000101792 GCAGTGCACGAGAAAGTCAAT pLKO.1 1071 CDS 100% 4.950 3.465 N Sept1 n/a
4 TRCN0000101791 CTCTACTTCATCTCACCCTTT pLKO.1 1011 CDS 100% 4.050 2.430 N Sept1 n/a
5 TRCN0000157926 CCTCTACTTCATCTCACCCTT pLKO.1 1010 CDS 100% 2.640 1.584 N SEPTIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00444 pDONR223 100% 44% 46.9% None (many diffs) n/a
2 ccsbBroad304_00444 pLX_304 0% 44% 46.9% V5 (many diffs) n/a
3 TRCN0000467119 CCTCTCCCACGGCCTAATGCTCAA pLX_317 34.1% 44% 46.9% V5 (many diffs) n/a
Download CSV