Transcript: Mouse XM_011241865.1

PREDICTED: Mus musculus START domain containing 10 (Stard10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stard10 (56018)
Length:
1404
CDS:
135..1229

Additional Resources:

NCBI RefSeq record:
XM_011241865.1
NBCI Gene record:
Stard10 (56018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105064 ACTCAGTGAAACACCCTAAAT pLKO.1 796 CDS 100% 13.200 9.240 N Stard10 n/a
2 TRCN0000349194 ACTCAGTGAAACACCCTAAAT pLKO_005 796 CDS 100% 13.200 9.240 N Stard10 n/a
3 TRCN0000105060 CGCTGATTACATCATTATGAA pLKO.1 773 CDS 100% 5.625 3.938 N Stard10 n/a
4 TRCN0000316766 CGCTGATTACATCATTATGAA pLKO_005 773 CDS 100% 5.625 3.938 N Stard10 n/a
5 TRCN0000105062 CCTGAAGAACCGTGATGTCAT pLKO.1 725 CDS 100% 4.950 3.465 N Stard10 n/a
6 TRCN0000156337 CCTGAAGAACCGTGATGTCAT pLKO.1 725 CDS 100% 4.950 3.465 N STARD10 n/a
7 TRCN0000316695 CCTGAAGAACCGTGATGTCAT pLKO_005 725 CDS 100% 4.950 3.465 N Stard10 n/a
8 TRCN0000105061 GCATGACATAGAATACAGAAA pLKO.1 611 CDS 100% 4.950 3.465 N Stard10 n/a
9 TRCN0000316765 GCATGACATAGAATACAGAAA pLKO_005 611 CDS 100% 4.950 3.465 N Stard10 n/a
10 TRCN0000105063 AGAAAGAAGTGGGACAGTAAT pLKO.1 627 CDS 100% 13.200 7.920 N Stard10 n/a
11 TRCN0000316764 AGAAAGAAGTGGGACAGTAAT pLKO_005 627 CDS 100% 13.200 7.920 N Stard10 n/a
12 TRCN0000154633 CAAGGCCATGAAGAAGATGTA pLKO.1 980 CDS 100% 4.950 2.970 N STARD10 n/a
13 TRCN0000157910 CCCAAGTGGGTGGTGAATAAA pLKO.1 939 CDS 100% 15.000 10.500 N STARD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02532 pDONR223 100% 72.8% 77.7% None (many diffs) n/a
2 ccsbBroad304_02532 pLX_304 0% 72.8% 77.7% V5 (many diffs) n/a
Download CSV