Transcript: Mouse XM_011241895.2

PREDICTED: Mus musculus leucine rich repeat containing 51 (Lrrc51), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc51 (69358)
Length:
798
CDS:
138..716

Additional Resources:

NCBI RefSeq record:
XM_011241895.2
NBCI Gene record:
Lrrc51 (69358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347011 CCATTGACCCTGTCCTAACAA pLKO_005 415 CDS 100% 5.625 7.875 N Lrrc51 n/a
2 TRCN0000347093 ATGTCCTCAATGATCTGAAAG pLKO_005 313 CDS 100% 10.800 7.560 N Lrrc51 n/a
3 TRCN0000346941 ATGGTCCAAGATCTGGTAACC pLKO_005 210 CDS 100% 4.050 2.835 N Lrrc51 n/a
4 TRCN0000131103 GCATGAACATCAAGCCCAAGA pLKO.1 667 CDS 100% 4.050 2.835 N LRTOMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05241 pDONR223 100% 87% 85.9% None (many diffs) n/a
2 ccsbBroad304_05241 pLX_304 0% 87% 85.9% V5 (many diffs) n/a
3 TRCN0000475834 TGGGCCAAAGTAAAATCCATAGAT pLX_317 41% 87% 85.9% V5 (many diffs) n/a
Download CSV