Transcript: Mouse XM_011241941.2

PREDICTED: Mus musculus suppression of tumorigenicity 5 (St5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St5 (76954)
Length:
4470
CDS:
263..3742

Additional Resources:

NCBI RefSeq record:
XM_011241941.2
NBCI Gene record:
St5 (76954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042439 CGTCAGCTTATCCGAATCTTT pLKO.1 2978 CDS 100% 5.625 7.875 N St5 n/a
2 TRCN0000042442 CCCTGAAGTCTCCTATCAGTT pLKO.1 2398 CDS 100% 4.950 3.465 N St5 n/a
3 TRCN0000042441 CCTGGGCAACAAGATGAAGTT pLKO.1 3703 CDS 100% 4.950 3.465 N St5 n/a
4 TRCN0000042438 CCTTCACCATATTCCAGGATA pLKO.1 3868 3UTR 100% 4.950 3.465 N St5 n/a
5 TRCN0000042440 CCTAAGACTAAGCCAAGCAAT pLKO.1 1457 CDS 100% 4.950 2.970 N St5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07005 pDONR223 100% 87.7% 90.7% None (many diffs) n/a
2 ccsbBroad304_07005 pLX_304 0% 87.7% 90.7% V5 (many diffs) n/a
3 TRCN0000492045 ACAGCCTGGCCCTACACCTATTGT pLX_317 8.5% 87.7% 90.7% V5 (many diffs) n/a
Download CSV