Transcript: Mouse XM_011242036.2

PREDICTED: Mus musculus ephrin B2 (Efnb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Efnb2 (13642)
Length:
10157
CDS:
5794..6804

Additional Resources:

NCBI RefSeq record:
XM_011242036.2
NBCI Gene record:
Efnb2 (13642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066496 GTGACGTTATCATACCACTAA pLKO.1 6662 CDS 100% 4.950 6.930 N Efnb2 n/a
2 TRCN0000336422 CGGACAAGGCCTGGTACTATA pLKO_005 5934 CDS 100% 13.200 10.560 N Efnb2 n/a
3 TRCN0000066493 CGGGTGTTACAGTAGCCTTAT pLKO.1 9451 3UTR 100% 10.800 8.640 N Efnb2 n/a
4 TRCN0000336370 AGGAGACAAATTGGATATTAT pLKO_005 5964 CDS 100% 15.000 10.500 N Efnb2 n/a
5 TRCN0000276537 ACTGTTGGCCAGTATGAATAT pLKO_005 6007 CDS 100% 13.200 9.240 N EFNB2 n/a
6 TRCN0000336368 GAGCTAGAAGCTGGTACAAAT pLKO_005 6352 CDS 100% 13.200 9.240 N Efnb2 n/a
7 TRCN0000066494 GCACAATTAAGAAGGAGAATA pLKO.1 6068 CDS 100% 13.200 9.240 N Efnb2 n/a
8 TRCN0000336367 TGCCGTGCACACTGGACTTAT pLKO_005 7152 3UTR 100% 13.200 9.240 N Efnb2 n/a
9 TRCN0000276588 TCTACATCAAATGGGTCTTTG pLKO_005 6208 CDS 100% 10.800 7.560 N EFNB2 n/a
10 TRCN0000336397 TCTACATCAAATGGGTCTTTG pLKO_005 6208 CDS 100% 10.800 7.560 N Efnb2 n/a
11 TRCN0000066495 CGCATCAGGATGCATCATCTT pLKO.1 6495 CDS 100% 4.950 3.465 N Efnb2 n/a
12 TRCN0000058427 CTGGTACTATACCCACAGATA pLKO.1 5944 CDS 100% 4.950 3.465 N EFNB2 n/a
13 TRCN0000066497 CCAAGATGTGAAATTCACCAT pLKO.1 6117 CDS 100% 2.640 1.848 N Efnb2 n/a
14 TRCN0000114051 GCCTGGTTTACAGAGTGAGTT pLKO.1 4182 5UTR 100% 4.950 2.475 Y H2-T3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00486 pDONR223 100% 85.3% 85.6% None (many diffs) n/a
2 ccsbBroad304_00486 pLX_304 0% 85.3% 85.6% V5 (many diffs) n/a
3 TRCN0000469739 GATTGACCGCAAACCTGATAAGTT pLX_317 32% 85.3% 85.6% V5 (many diffs) n/a
Download CSV