Transcript: Mouse XM_011242137.1

PREDICTED: Mus musculus DNA segment, Chr 8, ERATO Doi 82, expressed (D8Ertd82e), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prag1 (244418)
Length:
5002
CDS:
511..4632

Additional Resources:

NCBI RefSeq record:
XM_011242137.1
NBCI Gene record:
Prag1 (244418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088710 CCACGTACAAGACCAACAGAA pLKO.1 1330 CDS 100% 4.950 6.930 N Prag1 n/a
2 TRCN0000088708 GCCAAGTATGGACAGGTGATA pLKO.1 1772 CDS 100% 4.950 6.930 N Prag1 n/a
3 TRCN0000362256 TAGACGACGAAGGCGTGAATG pLKO_005 677 CDS 100% 10.800 8.640 N Prag1 n/a
4 TRCN0000362255 AGAGGACCACAGGACTATTTA pLKO_005 1896 CDS 100% 15.000 10.500 N Prag1 n/a
5 TRCN0000088711 CCAAAGTCAAGGCACCTGTTA pLKO.1 2587 CDS 100% 4.950 3.465 N Prag1 n/a
6 TRCN0000037424 GCACAACTGGATCGACATGAA pLKO.1 4464 CDS 100% 4.950 3.465 N PRAG1 n/a
7 TRCN0000088709 CCTAAGCCATTCAGAAACCAA pLKO.1 2982 CDS 100% 3.000 2.100 N Prag1 n/a
8 TRCN0000088712 CCTTGAACTCTGGAAACCGTT pLKO.1 3038 CDS 100% 2.640 1.848 N Prag1 n/a
9 TRCN0000362257 TGTTGTCCTTGGATGTAATAT pLKO_005 4720 3UTR 100% 15.000 9.000 N Prag1 n/a
10 TRCN0000362333 ACCCTGGGAAATGGTACAAAT pLKO_005 4696 3UTR 100% 13.200 7.920 N Prag1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.