Transcript: Mouse XM_011242138.1

PREDICTED: Mus musculus sarcoglycan zeta (Sgcz), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgcz (244431)
Length:
9196
CDS:
2878..3774

Additional Resources:

NCBI RefSeq record:
XM_011242138.1
NBCI Gene record:
Sgcz (244431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150690 GAATCCGACTTGAAGGTATAT pLKO.1 3107 CDS 100% 13.200 18.480 N SGCZ n/a
2 TRCN0000098356 CTACCATTGTATGTGAAAGAA pLKO.1 3139 CDS 100% 5.625 7.875 N Sgcz n/a
3 TRCN0000098359 CATGATAGTTAACTTAGCCAT pLKO.1 3015 CDS 100% 2.640 3.696 N Sgcz n/a
4 TRCN0000098357 TGGGAAATCTACCAATCGGTT pLKO.1 3611 CDS 100% 2.640 3.696 N Sgcz n/a
5 TRCN0000098355 GTTGGTTACCATGATAGTTAA pLKO.1 3006 CDS 100% 13.200 9.240 N Sgcz n/a
6 TRCN0000155536 GATGGCGAAAGAGGTGCTTAT pLKO.1 2966 CDS 100% 10.800 7.560 N SGCZ n/a
7 TRCN0000098358 GACAGAAATGTAACAGTGAAT pLKO.1 3199 CDS 100% 4.950 3.465 N Sgcz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13194 pDONR223 100% 79.1% 84.2% None (many diffs) n/a
2 ccsbBroad304_13194 pLX_304 0% 79.1% 84.2% V5 (many diffs) n/a
3 TRCN0000465634 AGCACCTTTTTCTGGCCAACCAGT pLX_317 35.3% 79.1% 84.2% V5 (many diffs) n/a
Download CSV