Transcript: Mouse XM_011242139.2

PREDICTED: Mus musculus sarcoglycan zeta (Sgcz), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgcz (244431)
Length:
2436
CDS:
1876..2355

Additional Resources:

NCBI RefSeq record:
XM_011242139.2
NBCI Gene record:
Sgcz (244431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150690 GAATCCGACTTGAAGGTATAT pLKO.1 2144 CDS 100% 13.200 18.480 N SGCZ n/a
2 TRCN0000098356 CTACCATTGTATGTGAAAGAA pLKO.1 2176 CDS 100% 5.625 7.875 N Sgcz n/a
3 TRCN0000098359 CATGATAGTTAACTTAGCCAT pLKO.1 2052 CDS 100% 2.640 3.696 N Sgcz n/a
4 TRCN0000098355 GTTGGTTACCATGATAGTTAA pLKO.1 2043 CDS 100% 13.200 9.240 N Sgcz n/a
5 TRCN0000155536 GATGGCGAAAGAGGTGCTTAT pLKO.1 2003 CDS 100% 10.800 7.560 N SGCZ n/a
6 TRCN0000098358 GACAGAAATGTAACAGTGAAT pLKO.1 2236 CDS 100% 4.950 3.465 N Sgcz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13194 pDONR223 100% 30.5% 30.7% None (many diffs) n/a
2 ccsbBroad304_13194 pLX_304 0% 30.5% 30.7% V5 (many diffs) n/a
3 TRCN0000465634 AGCACCTTTTTCTGGCCAACCAGT pLX_317 35.3% 30.5% 30.7% V5 (many diffs) n/a
Download CSV