Transcript: Mouse XM_011242242.2

PREDICTED: Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Palld (72333)
Length:
5190
CDS:
231..4457

Additional Resources:

NCBI RefSeq record:
XM_011242242.2
NBCI Gene record:
Palld (72333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090755 GCCGGCATCTACACATGTATT pLKO.1 3912 CDS 100% 13.200 18.480 N Palld n/a
2 TRCN0000306642 AGCCAAAGATCTATTGGTTTA pLKO_005 3391 CDS 100% 10.800 15.120 N Palld n/a
3 TRCN0000306575 GGAGTCAACGGGCTGATTAAT pLKO_005 2103 CDS 100% 15.000 10.500 N Palld n/a
4 TRCN0000306641 AGAAGGAGATCTCGCAGATTT pLKO_005 412 CDS 100% 13.200 9.240 N Palld n/a
5 TRCN0000306577 AGCAGGACAGAACTCGTTTAA pLKO_005 3944 CDS 100% 13.200 9.240 N Palld n/a
6 TRCN0000090756 GCTAACCTATGAGGAAAGAAT pLKO.1 3029 CDS 100% 5.625 3.938 N Palld n/a
7 TRCN0000327180 GCTAACCTATGAGGAAAGAAT pLKO_005 3029 CDS 100% 5.625 3.938 N Palld n/a
8 TRCN0000090754 CCCTTGTCATTGCTGAGAGTT pLKO.1 1765 CDS 100% 4.950 3.465 N Palld n/a
9 TRCN0000090757 CCATATTTAGAGAAGCGGCAA pLKO.1 775 CDS 100% 2.160 1.512 N Palld n/a
10 TRCN0000090753 GCAGAGTTTATTTGGAGTGTA pLKO.1 1108 CDS 100% 4.950 2.970 N Palld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02713 pDONR223 100% 66.8% 68.9% None (many diffs) n/a
2 ccsbBroad304_02713 pLX_304 0% 66.8% 68.9% V5 (many diffs) n/a
3 TRCN0000481534 GAATCCATCTCAACTATATTATTT pLX_317 14% 66.8% 68.9% V5 (many diffs) n/a
Download CSV