Transcript: Mouse XM_011242315.1

PREDICTED: Mus musculus microtubule associated serine/threonine kinase 3 (Mast3), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mast3 (546071)
Length:
3745
CDS:
16..3603

Additional Resources:

NCBI RefSeq record:
XM_011242315.1
NBCI Gene record:
Mast3 (546071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367267 TCTGGTCACTTCCCGCTATTT pLKO_005 894 CDS 100% 13.200 9.240 N Mast3 n/a
2 TRCN0000197052 GCGACTTTGAGACCATCAAAC pLKO.1 1292 CDS 100% 1.080 0.864 N MAST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489717 TTTCATTAGAAACCTGAATTGTAC pLX_317 17.5% 46.3% 49.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491941 ATCCCACGGCATTCTGCCTCAGCT pLX_317 21.1% 46.3% 49.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV