Transcript: Mouse XM_011242411.1

PREDICTED: Mus musculus single-pass membrane protein with coiled-coil domains 4 (Smco4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smco4 (170748)
Length:
1145
CDS:
505..684

Additional Resources:

NCBI RefSeq record:
XM_011242411.1
NBCI Gene record:
Smco4 (170748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249506 GAGCACGTCCATTCTGCTTTC pLKO_005 683 CDS 100% 6.000 8.400 N Smco4 n/a
2 TRCN0000184380 GTGCTCCTCATTGTCGTGTTT pLKO.1 628 CDS 100% 4.950 3.960 N Smco4 n/a
3 TRCN0000249507 TGGTCTTTGACTTGATCAATA pLKO_005 758 3UTR 100% 13.200 9.240 N Smco4 n/a
4 TRCN0000249505 TGCTCCTCATTGTCGTGTTTG pLKO_005 629 CDS 100% 10.800 7.560 N Smco4 n/a
5 TRCN0000249504 CAACTCAAAGGGAAGCCAAAG pLKO_005 511 CDS 100% 6.000 4.200 N Smco4 n/a
6 TRCN0000183782 CATTGTCGTGTTTGTGTATGT pLKO.1 636 CDS 100% 4.950 3.465 N Smco4 n/a
7 TRCN0000257892 GAGACCTCCAAGGACAAGAAG pLKO_005 535 CDS 100% 4.950 3.465 N Smco4 n/a
8 TRCN0000196150 GAAAGAGACCTCCAAGGACAA pLKO.1 531 CDS 100% 4.050 2.835 N Smco4 n/a
9 TRCN0000122362 CAAGGACAAGAAGGAGCGGAA pLKO.1 543 CDS 100% 2.160 1.296 N SMCO4 n/a
10 TRCN0000167108 CTCTGGTCTTTGACTTGATTA pLKO.1 755 3UTR 100% 13.200 9.240 N SMCO4 n/a
11 TRCN0000280777 CTCTGGTCTTTGACTTGATTA pLKO_005 755 3UTR 100% 13.200 9.240 N SMCO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08668 pDONR223 100% 88.7% 96.6% None (many diffs) n/a
2 ccsbBroad304_08668 pLX_304 0% 88.7% 96.6% V5 (many diffs) n/a
3 TRCN0000466275 GACAACTTTTGTCCTCCGTTCTGC pLX_317 100% 88.7% 96.6% V5 (many diffs) n/a
Download CSV