Transcript: Mouse XM_011242594.1

PREDICTED: Mus musculus anillin, actin binding protein (Anln), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anln (68743)
Length:
3200
CDS:
225..2159

Additional Resources:

NCBI RefSeq record:
XM_011242594.1
NBCI Gene record:
Anln (68743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090267 CGCAACACTCTGGAATTGATT pLKO.1 1941 CDS 100% 5.625 3.938 N Anln n/a
2 TRCN0000309725 CGCAACACTCTGGAATTGATT pLKO_005 1941 CDS 100% 5.625 3.938 N Anln n/a
3 TRCN0000090266 GCCTAGAGAATGTAATTTCTT pLKO.1 586 CDS 100% 5.625 3.938 N Anln n/a
4 TRCN0000090264 GCAGCCTTCATTCTTCAGTTA pLKO.1 1483 CDS 100% 4.950 3.465 N Anln n/a
5 TRCN0000309796 GCAGCCTTCATTCTTCAGTTA pLKO_005 1483 CDS 100% 4.950 3.465 N Anln n/a
6 TRCN0000090263 GCAGGTTGTATTCTATGCTTT pLKO.1 2235 3UTR 100% 4.950 3.465 N Anln n/a
7 TRCN0000331985 GCAGGTTGTATTCTATGCTTT pLKO_005 2235 3UTR 100% 4.950 3.465 N Anln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12039 pDONR223 100% 54.9% 56.3% None (many diffs) n/a
2 ccsbBroad304_12039 pLX_304 0% 54.9% 56.3% V5 (many diffs) n/a
3 TRCN0000465225 GTCGCAGCGTATTGCCTGGATTGT pLX_317 20.8% 54.9% 56.3% V5 (many diffs) n/a
Download CSV