Transcript: Mouse XM_011242602.1

PREDICTED: Mus musculus transmembrane protein 25 (Tmem25), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem25 (71687)
Length:
2414
CDS:
399..1211

Additional Resources:

NCBI RefSeq record:
XM_011242602.1
NBCI Gene record:
Tmem25 (71687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125938 GCTCCCAACATGAGCTTAACT pLKO.1 390 5UTR 100% 5.625 7.875 N Tmem25 n/a
2 TRCN0000438617 AGGTGTCACCCAACATCTAAG pLKO_005 1519 3UTR 100% 10.800 8.640 N Tmem25 n/a
3 TRCN0000125935 CCATCCAACCTTCAGCTCAAT pLKO.1 1008 CDS 100% 4.950 3.465 N Tmem25 n/a
4 TRCN0000137565 CTCAATGACCTCACTCCAGAT pLKO.1 1023 CDS 100% 4.050 2.835 N TMEM25 n/a
5 TRCN0000125936 GCCCTCTTAAGTTCAGGTCAA pLKO.1 146 5UTR 100% 4.050 2.835 N Tmem25 n/a
6 TRCN0000125934 GCCTATTATATGTCCTACCTT pLKO.1 1546 3UTR 100% 3.000 2.100 N Tmem25 n/a
7 TRCN0000431865 CCAATAACCTGAAACTGAATA pLKO_005 955 CDS 100% 13.200 7.920 N Tmem25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09228 pDONR223 100% 52.4% 50.6% None (many diffs) n/a
2 ccsbBroad304_09228 pLX_304 0% 52.4% 50.6% V5 (many diffs) n/a
3 TRCN0000471803 GTGCACCCAGGGCCGTGACTGGAG pLX_317 37.8% 52.4% 50.6% V5 (many diffs) n/a
Download CSV