Transcript: Mouse XM_011242671.1

PREDICTED: Mus musculus myosin VI (Myo6), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo6 (17920)
Length:
2338
CDS:
280..2262

Additional Resources:

NCBI RefSeq record:
XM_011242671.1
NBCI Gene record:
Myo6 (17920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348128 GCACCAAAGGAACCGTTATAA pLKO_005 1490 CDS 100% 15.000 21.000 N Myo6 n/a
2 TRCN0000110522 CCCAGATAATTTCCGGTATTT pLKO.1 1080 CDS 100% 13.200 10.560 N Myo6 n/a
3 TRCN0000110524 GCTCTCATAAACCAAGTATTT pLKO.1 406 CDS 100% 13.200 10.560 N Myo6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01058 pDONR223 100% 45.3% 49.6% None (many diffs) n/a
2 ccsbBroad304_01058 pLX_304 0% 45.3% 49.6% V5 (many diffs) n/a
3 TRCN0000479334 CACGAGCCTCTGTTGTAATCAACC pLX_317 10.9% 45.3% 49.6% V5 (many diffs) n/a
Download CSV