Transcript: Mouse XM_011242700.1

PREDICTED: Mus musculus DIS3 like exosome 3'-5' exoribonuclease (Dis3l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dis3l (213550)
Length:
4569
CDS:
1776..4535

Additional Resources:

NCBI RefSeq record:
XM_011242700.1
NBCI Gene record:
Dis3l (213550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120755 CCGATCAGCTTACAAACTGTT pLKO.1 3119 CDS 100% 4.950 6.930 N Dis3l n/a
2 TRCN0000120752 CGAGATTATGTGGTGACATTT pLKO.1 2400 CDS 100% 13.200 9.240 N Dis3l n/a
3 TRCN0000120754 GCTGCATAGCTGATGGAGTTA pLKO.1 3991 CDS 100% 4.950 3.465 N Dis3l n/a
4 TRCN0000120756 CCCAGGAACTACTGGACGGAA pLKO.1 3151 CDS 100% 0.880 0.616 N Dis3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09421 pDONR223 100% 81.9% 86.9% None (many diffs) n/a
2 ccsbBroad304_09421 pLX_304 0% 81.9% 86.9% V5 (many diffs) n/a
3 TRCN0000479100 TCCCGTAAGACTGGGTCGTATCCT pLX_317 13.5% 81.9% 86.9% V5 (many diffs) n/a
Download CSV