Transcript: Mouse XM_011242784.2

PREDICTED: Mus musculus snurportin 1 (Snupn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snupn (66069)
Length:
1414
CDS:
105..1181

Additional Resources:

NCBI RefSeq record:
XM_011242784.2
NBCI Gene record:
Snupn (66069)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198358 GATAGCCATTAGTGACCTTAT pLKO.1 1222 3UTR 100% 10.800 15.120 N Snupn n/a
2 TRCN0000182386 GAGGACAGTGATGATAGCCAT pLKO.1 1210 3UTR 100% 2.640 2.112 N Snupn n/a
3 TRCN0000181573 GCTCCAACAGATTATTGAGCA pLKO.1 1025 CDS 100% 2.640 2.112 N Snupn n/a
4 TRCN0000296180 ATGCTTTCTGAGTGGTTAATT pLKO_005 414 CDS 100% 15.000 10.500 N SNUPN n/a
5 TRCN0000198359 GCTTTCTGAGTGGTTAATTGA pLKO.1 416 CDS 100% 5.625 3.938 N Snupn n/a
6 TRCN0000181283 CCCTAGCAAGAAGTTACCAAA pLKO.1 374 CDS 100% 4.950 3.465 N Snupn n/a
7 TRCN0000182246 CAGAAATCCAAGCGGTTGGAT pLKO.1 255 CDS 100% 0.300 0.210 N Snupn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02304 pDONR223 100% 88.6% 91.7% None (many diffs) n/a
2 ccsbBroad304_02304 pLX_304 0% 88.6% 91.7% V5 (many diffs) n/a
3 TRCN0000474119 GTCGATAACATGGTTGCAACCATG pLX_317 37.9% 88.6% 91.7% V5 (many diffs) n/a
Download CSV