Transcript: Mouse XM_011242794.2

PREDICTED: Mus musculus TBC1 domain family, member 2B (Tbc1d2b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d2b (67016)
Length:
5608
CDS:
110..2629

Additional Resources:

NCBI RefSeq record:
XM_011242794.2
NBCI Gene record:
Tbc1d2b (67016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106074 GCAAGATTCGATGTCCATATT pLKO.1 2371 CDS 100% 13.200 18.480 N Tbc1d2b n/a
2 TRCN0000106072 GCAGTAAAGGAGTCGCTAGTT pLKO.1 570 CDS 100% 4.950 6.930 N Tbc1d2b n/a
3 TRCN0000106070 GCCCAGTGATTGGAAACGAAA pLKO.1 4410 3UTR 100% 4.950 6.930 N Tbc1d2b n/a
4 TRCN0000106071 GCGTTACTTCACTCGGACTAT pLKO.1 2401 CDS 100% 4.950 6.930 N Tbc1d2b n/a
5 TRCN0000106073 CCAGGTTGAAAGTAAATACTT pLKO.1 1345 CDS 100% 5.625 3.938 N Tbc1d2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11676 pDONR223 100% 81.7% 82.3% None (many diffs) n/a
2 TRCN0000476863 ATCCATATACTTACAGTTGACGCA pLX_317 15.5% 81.7% 82.3% V5 (many diffs) n/a
Download CSV