Transcript: Mouse XM_011242860.2

PREDICTED: Mus musculus RNA binding motif protein 6 (Rbm6), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm6 (19654)
Length:
2163
CDS:
254..2044

Additional Resources:

NCBI RefSeq record:
XM_011242860.2
NBCI Gene record:
Rbm6 (19654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427817 GTCATGTTTGCTCGATATAAA pLKO_005 2012 CDS 100% 15.000 21.000 N RBM6 n/a
2 TRCN0000295752 TCTACTACTGGCTACTATTAT pLKO_005 1058 CDS 100% 15.000 21.000 N Rbm6 n/a
3 TRCN0000054744 CGCGAGGAAATGACCAAGAAA pLKO.1 1478 CDS 100% 5.625 4.500 N Rbm6 n/a
4 TRCN0000422718 GACTGGTCTTCAGATACAAAT pLKO_005 995 CDS 100% 13.200 9.240 N RBM6 n/a
5 TRCN0000054746 GAGTCATGTTTGCTCGATATA pLKO.1 2010 CDS 100% 13.200 9.240 N Rbm6 n/a
6 TRCN0000288365 GAGTCATGTTTGCTCGATATA pLKO_005 2010 CDS 100% 13.200 9.240 N Rbm6 n/a
7 TRCN0000054745 CCTGCTGATAAGGAGCATGAA pLKO.1 467 CDS 100% 4.950 3.465 N Rbm6 n/a
8 TRCN0000288366 CCTGCTGATAAGGAGCATGAA pLKO_005 467 CDS 100% 4.950 3.465 N Rbm6 n/a
9 TRCN0000054743 CCTGGAAATTCACCGGAAGAT pLKO.1 1621 CDS 100% 4.950 3.465 N Rbm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07565 pDONR223 100% 87.6% 89.3% None (many diffs) n/a
2 ccsbBroad304_07565 pLX_304 0% 87.6% 89.3% V5 (many diffs) n/a
3 TRCN0000470808 ATATTGCACCGCAATAGTACTGAT pLX_317 27.9% 87.6% 89.3% V5 (many diffs) n/a
Download CSV