Transcript: Mouse XM_011242999.2

PREDICTED: Mus musculus CKLF-like MARVEL transmembrane domain containing 8 (Cmtm8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cmtm8 (70031)
Length:
827
CDS:
206..508

Additional Resources:

NCBI RefSeq record:
XM_011242999.2
NBCI Gene record:
Cmtm8 (70031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104920 CCAGAACGAATCCCACTGTTA pLKO.1 543 3UTR 100% 4.950 3.960 N Cmtm8 n/a
2 TRCN0000104923 TGGAAACACGTACTTCAGTTT pLKO.1 457 CDS 100% 4.950 3.960 N Cmtm8 n/a
3 TRCN0000104922 CTATGCTGGAAACACGTACTT pLKO.1 451 CDS 100% 4.950 3.465 N Cmtm8 n/a
4 TRCN0000164561 CTCACCGTCTTCTTCCTCATT pLKO.1 233 CDS 100% 4.950 3.465 N CMTM8 n/a
5 TRCN0000104924 GTGCTTTAATGGCAGTGCCTT pLKO.1 313 CDS 100% 2.640 1.848 N Cmtm8 n/a
6 TRCN0000104921 ACCCTGACTTACACCAGGATT pLKO.1 263 CDS 100% 4.950 2.970 N Cmtm8 n/a
7 TRCN0000241573 CACCGTCTTCTTCCTCATTAT pLKO_005 235 CDS 100% 13.200 9.240 N CMTM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09682 pDONR223 100% 50.6% 52.6% None (many diffs) n/a
2 ccsbBroad304_09682 pLX_304 0% 50.6% 52.6% V5 (many diffs) n/a
3 TRCN0000467687 AATCACCCGCAGAAGCTTTCGACG pLX_317 81% 50.6% 52.6% V5 (many diffs) n/a
Download CSV