Transcript: Mouse XM_011243079.1

PREDICTED: Mus musculus Cnksr family member 3 (Cnksr3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnksr3 (215748)
Length:
3594
CDS:
631..2367

Additional Resources:

NCBI RefSeq record:
XM_011243079.1
NBCI Gene record:
Cnksr3 (215748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362545 CAGTGCTCCGTGGCAACTTTA pLKO_005 2452 3UTR 100% 13.200 9.240 N Cnksr3 n/a
2 TRCN0000362546 GTCAACCAGAGGGCATCAAAT pLKO_005 2524 3UTR 100% 13.200 9.240 N Cnksr3 n/a
3 TRCN0000088563 CCGTGGCAACTTTACTTCATT pLKO.1 2459 3UTR 100% 5.625 3.938 N Cnksr3 n/a
4 TRCN0000088566 GCCTTGAAACTGATACTATGA pLKO.1 923 CDS 100% 4.950 3.465 N Cnksr3 n/a
5 TRCN0000088564 GCTCTACTACAGACCCTGTTA pLKO.1 1286 CDS 100% 4.950 3.465 N Cnksr3 n/a
6 TRCN0000088565 CGCAGATTTACCATTGCAGAT pLKO.1 1882 CDS 100% 4.050 2.835 N Cnksr3 n/a
7 TRCN0000088567 GCAGCCATATGTGCACAAGTT pLKO.1 768 CDS 100% 0.000 0.000 N Cnksr3 n/a
8 TRCN0000362611 GAGAGCCAAAGACGCAGATTT pLKO_005 1870 CDS 100% 13.200 7.920 N Cnksr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09705 pDONR223 100% 80.4% 86.7% None (many diffs) n/a
2 ccsbBroad304_09705 pLX_304 0% 80.4% 86.7% V5 (many diffs) n/a
3 TRCN0000467888 ATGGTCTCAACACTATACTAAACG pLX_317 23.9% 80.4% 86.7% V5 (many diffs) n/a
Download CSV