Transcript: Mouse XM_011243166.2

PREDICTED: Mus musculus tumor protein D52-like 1 (Tpd52l1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpd52l1 (21987)
Length:
1458
CDS:
16..990

Additional Resources:

NCBI RefSeq record:
XM_011243166.2
NBCI Gene record:
Tpd52l1 (21987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088395 CTCGGCATGAATCTGATGAAT pLKO.1 625 CDS 100% 5.625 3.938 N Tpd52l1 n/a
2 TRCN0000088394 GCAAGCCTCAAGACGAAAGTA pLKO.1 850 CDS 100% 5.625 3.938 N Tpd52l1 n/a
3 TRCN0000088396 ACTCGGCATGAATCTGATGAA pLKO.1 624 CDS 100% 4.950 3.465 N Tpd52l1 n/a
4 TRCN0000088393 CCAATCATGCAGATACTGATT pLKO.1 1246 3UTR 100% 0.495 0.347 N Tpd52l1 n/a
5 TRCN0000088397 GAAGACGAAATCACAACATTA pLKO.1 553 CDS 100% 13.200 7.920 N Tpd52l1 n/a
6 TRCN0000158076 CTTCTCTAGCATGCTCTCTGA pLKO.1 492 CDS 100% 2.640 1.584 N TPD52L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01698 pDONR223 100% 38.6% 38.5% None (many diffs) n/a
2 ccsbBroad304_01698 pLX_304 0% 38.6% 38.5% V5 (many diffs) n/a
3 TRCN0000468399 GATCTATAGATACCTGTTGATCTT pLX_317 76.9% 38.6% 38.5% V5 (many diffs) n/a
Download CSV