Transcript: Mouse XM_011243210.2

PREDICTED: Mus musculus ABRA C-terminal like (Abracl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abracl (73112)
Length:
715
CDS:
98..343

Additional Resources:

NCBI RefSeq record:
XM_011243210.2
NBCI Gene record:
Abracl (73112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267766 ACGTGAATTTCCTTATGTATT pLKO_005 401 3UTR 100% 13.200 9.240 N Abracl n/a
2 TRCN0000283544 TAATTGGGAAATGTAGGTAAT pLKO_005 534 3UTR 100% 10.800 7.560 N Abracl n/a
3 TRCN0000267712 ATTCATCGCCTGGGTTCCAGA pLKO_005 137 CDS 100% 2.640 1.848 N Abracl n/a
4 TRCN0000267768 TCTTAAGAAGGTAATTGGGAA pLKO_005 523 3UTR 100% 2.640 1.848 N Abracl n/a
5 TRCN0000353227 TTGTATTGCTGCAAGATTAAT pLKO_005 324 CDS 100% 15.000 9.000 N Abracl n/a
6 TRCN0000263955 TGCAAGATTAATGTGGTTTAC pLKO_005 333 CDS 100% 10.800 7.560 N ABRACL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14238 pDONR223 100% 87.2% 91.3% None (many diffs) n/a
2 ccsbBroad304_14238 pLX_304 0% 87.2% 91.3% V5 (many diffs) n/a
3 TRCN0000469290 CTCAAGAGATTGGCTGTCACCGCA pLX_317 100% 87.2% 91.3% V5 (many diffs) n/a
Download CSV