Transcript: Mouse XM_011243399.2

PREDICTED: Mus musculus ilvB (bacterial acetolactate synthase)-like (Ilvbl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ilvbl (216136)
Length:
2233
CDS:
51..1979

Additional Resources:

NCBI RefSeq record:
XM_011243399.2
NBCI Gene record:
Ilvbl (216136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075982 GTGGTCAAGGTACTTCGTGAA pLKO.1 1869 CDS 100% 4.050 3.240 N Ilvbl n/a
2 TRCN0000222689 CGTGTGGTTGTCTGGTATTTA pLKO.1 783 CDS 100% 15.000 10.500 N Ilvbl n/a
3 TRCN0000075980 GCTGCCTCTTGATGTACTATA pLKO.1 701 CDS 100% 13.200 9.240 N Ilvbl n/a
4 TRCN0000075979 GCCTGTATTACAGCACCTGAA pLKO.1 1397 CDS 100% 4.050 2.835 N Ilvbl n/a
5 TRCN0000075978 GACTTTGTCTACCTGGAGTTT pLKO.1 2019 3UTR 100% 4.950 2.970 N Ilvbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07720 pDONR223 100% 83.1% 85% None (many diffs) n/a
2 ccsbBroad304_07720 pLX_304 0% 83.1% 85% V5 (many diffs) n/a
3 TRCN0000478634 ATATACCACATAAATGTAGTGGCG pLX_317 16.9% 83.1% 85% V5 (many diffs) n/a
4 ccsbBroadEn_07721 pDONR223 100% 83% 84.8% None (many diffs) n/a
5 ccsbBroad304_07721 pLX_304 0% 83% 84.8% V5 (many diffs) n/a
6 TRCN0000470732 ACCGCTTGCATTTGGGATTTCTGC pLX_317 22.7% 83% 84.8% V5 (many diffs) n/a
Download CSV