Transcript: Mouse XM_011243401.1

PREDICTED: Mus musculus ilvB (bacterial acetolactate synthase)-like (Ilvbl), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ilvbl (216136)
Length:
2353
CDS:
506..1711

Additional Resources:

NCBI RefSeq record:
XM_011243401.1
NBCI Gene record:
Ilvbl (216136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222689 CGTGTGGTTGTCTGGTATTTA pLKO.1 1208 CDS 100% 15.000 10.500 N Ilvbl n/a
2 TRCN0000075980 GCTGCCTCTTGATGTACTATA pLKO.1 1126 CDS 100% 13.200 9.240 N Ilvbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07721 pDONR223 100% 53.8% 54.5% None (many diffs) n/a
2 ccsbBroad304_07721 pLX_304 0% 53.8% 54.5% V5 (many diffs) n/a
3 TRCN0000470732 ACCGCTTGCATTTGGGATTTCTGC pLX_317 22.7% 53.8% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_07720 pDONR223 100% 53.8% 54.7% None (many diffs) n/a
5 ccsbBroad304_07720 pLX_304 0% 53.8% 54.7% V5 (many diffs) n/a
6 TRCN0000478634 ATATACCACATAAATGTAGTGGCG pLX_317 16.9% 53.8% 54.7% V5 (many diffs) n/a
Download CSV