Transcript: Mouse XM_011243406.2

PREDICTED: Mus musculus suppressor of cytokine signaling 2 (Socs2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Socs2 (216233)
Length:
6551
CDS:
711..1454

Additional Resources:

NCBI RefSeq record:
XM_011243406.2
NBCI Gene record:
Socs2 (216233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428912 TCAGATTGGATTCTATCATAT pLKO_005 1021 CDS 100% 13.200 18.480 N Socs2 n/a
2 TRCN0000067359 CCTACTAACTATATCCGTTAA pLKO.1 950 CDS 100% 10.800 8.640 N Socs2 n/a
3 TRCN0000057058 CGCATTCAGACTACCTACTAA pLKO.1 937 CDS 100% 5.625 4.500 N SOCS2 n/a
4 TRCN0000416957 TGAAGCCAAAGAGAAATTAAA pLKO_005 878 CDS 100% 15.000 10.500 N Socs2 n/a
5 TRCN0000067360 GCCTTTACCAACAAGACTAAA pLKO.1 1253 CDS 100% 13.200 9.240 N Socs2 n/a
6 TRCN0000067362 GTTCACCTGTACCTGACCAAA pLKO.1 1152 CDS 100% 4.950 3.465 N Socs2 n/a
7 TRCN0000067361 GCTCAGTCAAACAGGATGGTA pLKO.1 836 CDS 100% 3.000 2.100 N Socs2 n/a
8 TRCN0000057060 CAGAAGGAACTTTCTTGATTA pLKO.1 907 CDS 100% 13.200 7.920 N SOCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02028 pDONR223 100% 72.6% 74.8% None (many diffs) n/a
2 ccsbBroad304_02028 pLX_304 0% 72.6% 74.8% V5 (many diffs) n/a
3 TRCN0000473370 CTTGGCGAGCCTTGCCTCTACGGC pLX_317 91.2% 72.6% 74.8% V5 (many diffs) n/a
Download CSV