Transcript: Mouse XM_011243561.1

PREDICTED: Mus musculus tetraspanin 15 (Tspan15), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspan15 (70423)
Length:
1336
CDS:
88..678

Additional Resources:

NCBI RefSeq record:
XM_011243561.1
NBCI Gene record:
Tspan15 (70423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380856 TCACCCGTGTGGAGGACATTA pLKO_005 560 CDS 100% 13.200 9.240 N Tspan15 n/a
2 TRCN0000381580 GGGTGTATGTACCTGCGTATA pLKO_005 815 3UTR 100% 10.800 7.560 N Tspan15 n/a
3 TRCN0000380914 GTACTGCAAAGTGCATCTAAG pLKO_005 729 3UTR 100% 10.800 7.560 N Tspan15 n/a
4 TRCN0000381039 GCCTTGGCCAGTGGTCATTAT pLKO_005 971 3UTR 100% 13.200 7.920 N Tspan15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07901 pDONR223 100% 57.5% 54.8% None (many diffs) n/a
2 ccsbBroad304_07901 pLX_304 0% 57.5% 54.8% V5 (many diffs) n/a
3 TRCN0000477967 GTGCGGCTGTAGGATGTCGGGCCA pLX_317 57.8% 57.3% 54.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV