Transcript: Mouse XM_011243745.2

PREDICTED: Mus musculus endoplasmic reticulum lectin 1 (Erlec1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erlec1 (66753)
Length:
1800
CDS:
98..1051

Additional Resources:

NCBI RefSeq record:
XM_011243745.2
NBCI Gene record:
Erlec1 (66753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175150 GCTGAAGTTACAACTTGTGAA pLKO.1 224 CDS 100% 4.950 3.465 N Erlec1 n/a
2 TRCN0000176352 CCATCCTGAATCTAAGCATGA pLKO.1 190 CDS 100% 4.050 2.835 N Erlec1 n/a
3 TRCN0000175728 GCGTATCATCTTCAAGACGAT pLKO.1 734 CDS 100% 2.640 1.848 N Erlec1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03013 pDONR223 100% 52.8% 52.9% None (many diffs) n/a
2 ccsbBroad304_03013 pLX_304 0% 52.8% 52.9% V5 (many diffs) n/a
3 TRCN0000481231 CATGTAGCCTGCTGTAGTCGTCAA pLX_317 31.3% 52.8% 52.9% V5 (many diffs) n/a
4 ccsbBroadEn_03014 pDONR223 100% 43.4% 43.3% None (many diffs) n/a
5 ccsbBroad304_03014 pLX_304 0% 43.4% 43.3% V5 (many diffs) n/a
Download CSV