Transcript: Mouse XM_011244007.1

PREDICTED: Mus musculus MAP/microtubule affinity regulating kinase 3 (Mark3), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mark3 (17169)
Length:
2819
CDS:
883..2211

Additional Resources:

NCBI RefSeq record:
XM_011244007.1
NBCI Gene record:
Mark3 (17169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363374 AGCGGCGAACCGCAACATATA pLKO_005 1661 CDS 100% 13.200 18.480 N Mark3 n/a
2 TRCN0000361306 ACAGGCCGAGAGGTTGCAATA pLKO_005 51 5UTR 100% 10.800 15.120 N Mark3 n/a
3 TRCN0000363382 TCTGTTATTAGATGCGGATAT pLKO_005 368 5UTR 100% 10.800 15.120 N Mark3 n/a
4 TRCN0000361307 ACCTTAAGGCTAGTTGATAAT pLKO_005 2629 3UTR 100% 13.200 10.560 N Mark3 n/a
5 TRCN0000361259 GAGTAATATTTAGGCAATAAC pLKO_005 2280 3UTR 100% 13.200 10.560 N Mark3 n/a
6 TRCN0000361319 ACCCAGTAATTATGGTGTAAA pLKO_005 2211 CDS 100% 13.200 9.240 N Mark3 n/a
7 TRCN0000361308 CTGAATGGAGTCCGGTTTAAG pLKO_005 2122 CDS 100% 13.200 9.240 N Mark3 n/a
8 TRCN0000355524 GGTGAAGTATTTGACTATTTG pLKO_005 231 5UTR 100% 13.200 9.240 N MARK3 n/a
9 TRCN0000378657 TATGGTGGGAATGGGATATTC pLKO_005 821 5UTR 100% 13.200 9.240 N Mark3 n/a
10 TRCN0000221203 CCAAACAGTGACCTCAGCAAT pLKO.1 936 CDS 100% 4.950 3.465 N Mark3 n/a
11 TRCN0000221200 CGGGAAGTACAGAATCCCTTT pLKO.1 620 5UTR 100% 4.050 2.835 N Mark3 n/a
12 TRCN0000378206 ACGCCAATAACTGCGACTATG pLKO_005 2000 CDS 100% 10.800 15.120 N MARK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.