Transcript: Mouse XM_011244030.1

PREDICTED: Mus musculus RAD51 paralog B (Rad51b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rad51b (19363)
Length:
5270
CDS:
217..1437

Additional Resources:

NCBI RefSeq record:
XM_011244030.1
NBCI Gene record:
Rad51b (19363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071265 GCTTCTTCATACAGTAAGCAA pLKO.1 369 CDS 100% 3.000 2.400 N Rad51b n/a
2 TRCN0000071266 GCTGAGAGACTGGTTGAGATT pLKO.1 661 CDS 100% 4.950 3.465 N Rad51b n/a
3 TRCN0000071264 CCGTTTAAGCAGATACCAGAT pLKO.1 267 CDS 100% 4.050 2.835 N Rad51b n/a
4 TRCN0000071267 GCTTGTGATTGTTGACTCCAT pLKO.1 831 CDS 100% 2.640 1.848 N Rad51b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01369 pDONR223 100% 72% 70.7% None (many diffs) n/a
2 ccsbBroad304_01369 pLX_304 0% 72% 70.7% V5 (many diffs) n/a
3 TRCN0000470293 GTCAGAGCTCCATAACTAGATTTA pLX_317 32% 72% 70.7% V5 (many diffs) n/a
Download CSV