Construct: ORF TRCN0000470293
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002046.1_s317c1
- Derived from:
- ccsbBroadEn_01369
- DNA Barcode:
- GTCAGAGCTCCATAACTAGATTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD51B (5890)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470293
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5890 | RAD51B | RAD51 paralog B | NM_133509.4 | 100% | 100% | |
| 2 | human | 5890 | RAD51B | RAD51 paralog B | NM_002877.6 | 90.9% | 89.8% | (many diffs) |
| 3 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321812.1 | 90.4% | 89.8% | (many diffs) |
| 4 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321814.1 | 90.4% | 89.8% | (many diffs) |
| 5 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321809.1 | 90.1% | 89.8% | 1037_1037delGinsAGACAA;1039C>A;1041_1042ins106 |
| 6 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321810.1 | 90.1% | 89.8% | 1037_1037delGinsAGACAA;1039C>A;1041_1042ins106 |
| 7 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321819.1 | 90.1% | 89.8% | 1037_1039delCTGinsA;1042A>C;1044_1045ins110 |
| 8 | human | 5890 | RAD51B | RAD51 paralog B | NM_133510.4 | 90% | 89.6% | (many diffs) |
| 9 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321818.1 | 89.8% | 89.8% | 1037_1039delGGC;1041_1042ins114 |
| 10 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321821.1 | 84.6% | 84% | (many diffs) |
| 11 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321815.1 | 83.3% | 80.6% | (many diffs) |
| 12 | human | 5890 | RAD51B | RAD51 paralog B | NM_001321817.2 | 59.2% | 58.8% | (many diffs) |
| 13 | mouse | 19363 | Rad51b | RAD51 paralog B | NM_009014.3 | 77.6% | 76.9% | (many diffs) |
| 14 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_006515624.2 | 77.6% | 74.8% | (many diffs) |
| 15 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244036.2 | 76.8% | 75.5% | (many diffs) |
| 16 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_006515625.2 | 75.4% | 74.8% | (many diffs) |
| 17 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244035.2 | 74% | 72.8% | (many diffs) |
| 18 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_017315003.1 | 72.7% | 72% | (many diffs) |
| 19 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244034.2 | 72.6% | 71.4% | (many diffs) |
| 20 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244028.1 | 72% | 70.7% | (many diffs) |
| 21 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244029.1 | 72% | 70.7% | (many diffs) |
| 22 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244030.1 | 72% | 70.7% | (many diffs) |
| 23 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244031.2 | 72% | 70.7% | (many diffs) |
| 24 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244032.1 | 72% | 70.7% | (many diffs) |
| 25 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244033.1 | 72% | 70.7% | (many diffs) |
| 26 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_017315000.1 | 72% | 70.7% | (many diffs) |
| 27 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_017315001.1 | 70.8% | 69% | (many diffs) |
| 28 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_017315002.1 | 70.8% | 69% | (many diffs) |
| 29 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_006515622.2 | 70.8% | 68.3% | (many diffs) |
| 30 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244022.2 | 70.2% | 68.9% | (many diffs) |
| 31 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244026.2 | 70.2% | 68.9% | (many diffs) |
| 32 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_011244027.2 | 70.2% | 68.9% | (many diffs) |
| 33 | mouse | 19363 | Rad51b | RAD51 paralog B | XM_006515623.2 | 68.9% | 68.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1218
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tagcaagaaa ctaaaacgag tgggtttatc acaagagctg tgtgaccgtc 121 tgagtagaca tcagatcctt acctgtcagg actttttatg tctttcccca ctggagctta 181 tgaaggtgac tggtctgagt tatcgaggtg tccatgaact tctatgtatg gtcagcaggg 241 cctgtgcccc aaagatgcaa acggcttatg ggataaaagc acaaaggtct gctgatttct 301 caccagcatt cttatctact accctttctg ctttggacga agccctgcat ggtggtgtgg 361 cttgtggatc cctcacagag attacaggtc caccaggttg tggaaaaact cagttttgta 421 taatgatgag cattttggct acattaccca ccaacatggg aggattagaa ggagctgtgg 481 tgtacattga cacagagtct gcatttagtg ctgaaagact ggttgaaata gcagaatccc 541 gttttcccag atattttaac actgaagaaa agttactttt gacaagtagt aaagttcatc 601 tttatcggga actcacctgt gatgaagttc tacaaaggat tgaatctttg gaagaagaaa 661 ttatctcaaa aggaattaaa cttgtgattc ttgactctgt tgcttctgtg gtcagaaagg 721 agtttgatgc acaacttcaa ggcaatctca aagaaagaaa caagttcttg gcaagagagg 781 catcctcctt gaagtatttg gctgaggagt tttcaatccc agttatcttg acgaatcaga 841 ttacaaccca tcTGAGTGGA GCCCTGGCTT CTCAGGCAGA CCTGGTGTCT CCAGCTGATG 901 ATTTGTCCCT GTCTGAAGGC ACTTCTGGAT CCAGCTGTGT GATAGCCGCA CTAGGAAATA 961 CCTGGAGTCA CAGTGTGAAT ACCCGGCTGA TCCTCCAGTA CCTTGATTCA GAGAGAAGAC 1021 AGATTCTTAT TGCCAAGTCC CCTCTGGCTC CCTTCACCTC ATTTGTCTAC ACCATCAAGG 1081 AGGAAGGCCT GGTTCTTCAA GAGACAACAT TTTGCTCTGT CACCCAAGCT GAACTGAACT 1141 GGGCTCCAGA AATCCTCCCA CCTCAGCCTC CTGAGCAGCT AGGACTACAG ATGTGCCACC 1201 ATACCCAGCT AATTTTTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1261 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1321 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGTCAGAG CTCCATAACT 1381 AGATTTAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt