Transcript: Mouse XM_011244089.2

PREDICTED: Mus musculus protein-O-mannosyltransferase 2 (Pomt2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pomt2 (217734)
Length:
2183
CDS:
341..2077

Additional Resources:

NCBI RefSeq record:
XM_011244089.2
NBCI Gene record:
Pomt2 (217734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348140 CTGGCACTGGCCTATCAATTA pLKO_005 2159 3UTR 100% 13.200 18.480 N Pomt2 n/a
2 TRCN0000080471 GCAGCAGGTTACCACCTATTT pLKO.1 1660 CDS 100% 13.200 9.240 N Pomt2 n/a
3 TRCN0000334243 GCAGCAGGTTACCACCTATTT pLKO_005 1660 CDS 100% 13.200 9.240 N Pomt2 n/a
4 TRCN0000080469 CCTCACTCTATCCCAGTACAT pLKO.1 1108 CDS 100% 4.950 3.465 N Pomt2 n/a
5 TRCN0000348209 GTCACTGGCTATGGCATAAAT pLKO_005 1865 CDS 100% 15.000 9.000 N Pomt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08149 pDONR223 100% 55.1% 55.1% None (many diffs) n/a
2 ccsbBroad304_08149 pLX_304 0% 55.1% 55.1% V5 (many diffs) n/a
3 TRCN0000481169 GCCCCATGGAAAATAACTTCGGTT pLX_317 20.3% 55.1% 55.1% V5 (many diffs) n/a
Download CSV