Transcript: Mouse XM_011244165.1

PREDICTED: Mus musculus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit S (Atp5s), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp5s (68055)
Length:
1621
CDS:
187..789

Additional Resources:

NCBI RefSeq record:
XM_011244165.1
NBCI Gene record:
Atp5s (68055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429988 TGATACTAGACAGCTACAAAT pLKO_005 832 3UTR 100% 13.200 18.480 N Atp5s n/a
2 TRCN0000222665 CGATTCTTGTATCATGGACAT pLKO.1 465 CDS 100% 4.050 5.670 N Atp5s n/a
3 TRCN0000422966 AGTGTCTGGTGTCACTATTAA pLKO_005 794 3UTR 100% 15.000 10.500 N Atp5s n/a
4 TRCN0000076120 GCCTATTGGAACTGGAAATAA pLKO.1 602 CDS 100% 15.000 10.500 N Atp5s n/a
5 TRCN0000447371 CGTCATTGCTCTGCGACATTT pLKO_005 651 CDS 100% 13.200 9.240 N Atp5s n/a
6 TRCN0000076122 GTCATGTGACTCCAGATACTT pLKO.1 243 CDS 100% 5.625 3.938 N Atp5s n/a
7 TRCN0000076118 CCCATCTGCTTCAAACAAGAA pLKO.1 1456 3UTR 100% 4.950 3.465 N Atp5s n/a
8 TRCN0000076121 GATAAAGAATACCTTGCCCAA pLKO.1 718 CDS 100% 2.160 1.512 N Atp5s n/a
9 TRCN0000424000 ACTATGCAAGTGTCATTATAT pLKO_005 531 CDS 100% 15.000 9.000 N Atp5s n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.